58 669
Assignments Done
Successfully Done
In March 2018
Your physics homework can be a real challenge, and the due date can be really close — feel free to use our assistance and get the desired result.
Be sure that math assignments completed by our experts will be error-free and done according to your instructions specified in the submitted order form.
Our experts will gladly share their knowledge and help you with programming homework. Keep up with the world’s newest programming trends.

2 297Questions:

1 840Free Answers by our Experts:

Studying biology in high school, college or university, many students need to answer questions in various biology topics that they may find incomprehensible. While investigating the many aspects and applications of biology is as fascinated as life sciences can be, it may be hard and time-consuming, especially if you are required to answer a biology question as soon as possible. You need to get a clear understanding of the underlying concepts first; however, you may find that you still have problems understanding the material. The best option to go for in this case is to request free online help from our biology experts. Having your biology questions answered by a professional will significantly reduce the amount of time you spend working your way through your biology homework, lab or quiz, especially if you have been stuck for hours on just this one question! AssignmentExpert will gladly provide assistance with your questions in various branches of biology, including Biochemistry, Microbiology, Molecular Biology, Biomechanics and Bioinformatics. Ask your biology question here, and get a quick answer from our biology expert for free. If you need help with the whole biology homework or lab, order now, and our experts will help you for a reasonable price.

Ask Your question

Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Search & Filtering

Hi I want to know if you can answer these three questions

1. In which part(s) of cellular respiration is CO2 produced?

2. Which carb(s) was yeast able to use for cellular respiration

3. What equation describes the formation of carbonic acid?
The figure below depicts the relationship between fitness and phenotype (“character”), and how this relationship changes from Time 1 to Time 3 as the environment changes. “X” represents that average value of the character in a population. Selection is acting on this population in Time 1, moving the value of X towards maximum fitness. a) assuming at this point that selection is the only force acting on the population, explain why X gets “stuck” towards the left of the graph (a low value of the character) even as, by Time 3, a high value for the character confers the highest fitness . b) if other forces could act on this population, which one(s) could drive the population mean for the character to the right (to the global optimum)?
While water in her garden plants,she noticed that water droplets get accumulated on the surface of some plants and she wonders , why this is not seen in all plants ???
During fertilization sperm releases the enzymes hyaluronidase which dissolve the protective of ovum and helps the sperm penetrate easily.Apply the suitable mechanism for the process with the desired cell organelles.
During biological practicals,he noticed that
Sample A divides only once and give 2 daughter cells
Sample B cell divides twice and give 4 daughter cells
Identify the phenomenal and write any one distinguish feature
Which of the following most likely represents the specific gravity of granite?

You engineer a number of genetic mutations in E.coli's DNA and want to determine whether there is any change in size or relative abundance of the trytophanase operon mRNA produced by mutant strains. To do so, you will purify total mRNA from unmutated and mutated E.coli strains, run and separate the mRNAs on an agarose gel, and then perform a ___________ with a labelled nucleic acid probe to specifically visualize the tryptophanase mRNA.
you sequence the DNA of the tryptophanase operon promoter and obtain the DNA sequence shown below. Underline and name the two critical regions needed for binding the sigma 70 factor -40 AGAATAGACAAAAACTCTGAGTGTAATAATGCCTCGTAGATCG +6
What is mediated permeability? Discuss the types of mediated permeability.