62 476
Assignments Done
98,9%
Successfully Done
In June 2018

Microbiology Answers

Questions: 251

Free Answers by our Experts: 189

Ask Your question

Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Search & Filtering

What is the difference between spirillum and spirochaete bacteria ?
Most phases of the lifecycles of slime molds are ........ (Haploid/Diploid)
How do diatoms, dinoflagellates, and euglenoids store food ?
In Euglena, pellicle is ....

A. Thin and proteinaceous
B. Thin and lipoproteinaceous
C. Thick and proteinaceous
D. Thick and lipoproteinaceous
Approximately how many cells of staphylococci will be able to fit in the volume of a human red blood cell?
A. 10.
B. 1000.
C. 10000.
D. 50000
How many E.coli bacteria needed to stop one listeria bacteria? Or What is the ratio of E.coli to Listeria needed to feel better?
You engineer a number of genetic mutations in E.coli's DNA and want to determine whether there is any change in size or relative abundance of the trytophanase operon mRNA produced by mutant strains. To do so, you will purify total mRNA from unmutated and mutated E.coli strains, run and separate the mRNAs on an agarose gel, and then perform a ___________ with a labelled nucleic acid probe to specifically visualize the tryptophanase mRNA.
you sequence the DNA of the tryptophanase operon promoter and obtain the DNA sequence shown below. Underline and name the two critical regions needed for binding the sigma 70 factor -40 AGAATAGACAAAAACTCTGAGTGTAATAATGCCTCGTAGATCG +6
I am doing a project over microbes in our foods and I picked chocolate for my research. Can you help me identify if the microbe in chocolate is either Lactobacillus fermentum or Filamentous fungi. Please help.
Submit
Privacy policy Terms and Conditions