58 977
Assignments Done
Successfully Done
In March 2018
Your physics homework can be a real challenge, and the due date can be really close — feel free to use our assistance and get the desired result.
Be sure that math assignments completed by our experts will be error-free and done according to your instructions specified in the submitted order form.
Our experts will gladly share their knowledge and help you with programming homework. Keep up with the world’s newest programming trends.

Microbiology Answers


183Free Answers by our Experts:

Ask Your question

Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Search & Filtering

You engineer a number of genetic mutations in E.coli's DNA and want to determine whether there is any change in size or relative abundance of the trytophanase operon mRNA produced by mutant strains. To do so, you will purify total mRNA from unmutated and mutated E.coli strains, run and separate the mRNAs on an agarose gel, and then perform a ___________ with a labelled nucleic acid probe to specifically visualize the tryptophanase mRNA.
you sequence the DNA of the tryptophanase operon promoter and obtain the DNA sequence shown below. Underline and name the two critical regions needed for binding the sigma 70 factor -40 AGAATAGACAAAAACTCTGAGTGTAATAATGCCTCGTAGATCG +6
I am doing a project over microbes in our foods and I picked chocolate for my research. Can you help me identify if the microbe in chocolate is either Lactobacillus fermentum or Filamentous fungi. Please help.
May I know the recommended dilution factors for the strain Acetobacter nitrogenifigens sp. if i am presented with approx. 10^9 CFU/ml? If I am designing an experiment to test if the pH level is suitable for human intestinal flora, what would be the negative control to inhibit the growth of Acetobacter if I have to keep the temperature and conditions the same? Please help and thank you!
what is common between ameoba and elephant

Question 15 : Atmospheric nitrogen is directly useable by most organisms but has to be converted to stable organic form such as ____. I. Ammonium II. Ammonia III. Nitrate
I and III
I, II and III
I only
II only
Question 16 : The vaccine for the disease anthrax was developed between the period __
1870 -1880
1860 - 1870
1880 - 1890
1890 - 1900
Question 17 : The following are external structure of a bacterial cell wall except ____.
Spores and cysts
Question 18 : The following are types of asexual spores in fungi except ____.
Question 19 : When a culture of microorganisms is transferred from a nutritionally poor medium to a richer one,____ occurs.
shift up
shift left
shift right
shift down
Question 20 : Who pioneered the use of enrichment cultures and selective media?
Behring and Kitasato
Jenner and Kitasto
Beijerink and Winogradtsky
Jenner and Behring
Help identifying some bacteria upon CLED agar.
1) Yellow colonies, gram positive cocci, catalase positive, coagulase negative, oxidase negative.
2) Yellow colonies dark centre (brownish), gram negative bacilli, catalase positive, coagulase negative, oxidase negative.
3) Beige colonies, gram positive cocci, catalase positive, coagulase negative, oxidase positive
4) green colonies, catalase positive, oxidase positive (colonies were rough around edges and 1-2 mm)
List the central chemoreceptors in alphabetical order!?
Where is growth of white yeast saccharomyces cerevisiae in stab cultures draw an image
And write about why it occured
Describe the use of lawn and pour plates and consider why you might choose one of these methods over the other ?