Bioinformatics Answers

Questions: 108

Free Answers by our Experts: 93

Ask Your question

Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Search & Filtering

The RefSeq entry NM_000133.4 contains the sequence of the human mRNA coding for coagulation factor F9. The gene contains 8 coding exons and gives rise to a transcript of 2800 bp 

Next, we want to design primers to measure the expression of the F9 gene.

Go to refseq record to study its features.

Write the strategy and design the primers using primer blast .

Paste the screenshots as evidence


Prepare a table of complete 3 letter abbreviations of GenBank divisions (PRI, ROD, MAM, BCT etc.)


Access any flatfile from NCBI (The NCBI home page is http://www.ncbi.nlm.nih.gov ). Decode every information given in the accessed file

•       What is the first line indicating

•       What is the nature of the sequence

•       Identify the version

•       Is the data you have accessed is coding sequences or open reading frame? Which is the start and stop codon?

•       Has it got untranslated regions?

•       Has it been linked to the protein database? If connected, how many amino acids? What is the accession number?

•       Is the information published?


Calculate the dynamic programming matrix and the optimal local and global alignment for the DNA sequences

a: GAATTC and b: GATTA,

scoring +2 for a match,

-1 for a mismatch,

and using a linear gap penalty function W(L) = -2L

 Tiny openings or pores in plant tissue that allow for gas exchange


The PAM matrices are considered nonreciprocal, meaning that the probability of changing an amino acid such as alanine to arginine is not equal to the probability of changing an arginine to an alanine. Why?



Retrieve the following information of the given mouse genes : PGK1 , GAPDH , Alpha - globin , Insulin ; Gene ID , No. of Exons and Introns , CDS length & Introns length , Protein ID , Amino Acids sequence length . Present all the information in a tabular format. Sequences should be retrieved in both GenBank and Fasta Format.


For a given gene sequence, how do we find the 5' transcription start site. What is the % similarity to consensus initiator sequence responsible for transcription initiation. How do we identify and mark the binding site for TF 1 B.


YKYRYLRHGKLRPFERDI
YKYRYLKHGKLRPFERDI
YKYRYLXHGKLRPFERDI
YKYRSLRHGKLRPFERDI
YKYRCLRHGKLRPFERDI
YKFRYLRHGKLRPFERDI
YKHRYLRHGKLRPFERDI
YKXRYLRHGKLRPFERDI
YLYRWVRRSKLNPYERDL
FYYRLFRHGKIKPYERDI
FFYRRFRHGKIKPYGRDL
FYYRLFRHGKIKPYGRDL
YYYRIWRSEKLRPFERDI
YYYRSHRKTKLKPFERDL
YFYRSHRSTKLKPFERDL
YFYRSHRSSKLKPFERDL
YYYRSSRKTKLKPFERDL
YYYRSYRKEKLKPFERDL

Write a regular expression that describes the alignment in the box.

CS444: BIOINFORMATICS (Assignment 1 - Lab)

(To be made handwritten)

 

The following transcript was found to be abundant in a human patient’s blood sample.

>Example

ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCATGGTGCTGTCTCCTGCCGACAAGACCAACGTC

AAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCC

TGTCCTTCCCCACCACCAAGACCTACTTCCCGCACTTCGACCTGAGCCACGGCTCTGCCCAGGTTAAGGG

CCACGGCAAGAAGGTGGCCGACGCGCTGACCAACGCCGTGGCGCACGTGGACGACATGCCCAACGCGCTG

TCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCCGGTCAACTTCAAGCTCCTAAGCCACT

GCCTGCTGGTGACCCTGGCCGCCCACCTCCCCGCCGAGTTCACCCCTGCGGTGCACGCCTCCCTGGACAA

GTTCCTGGCTTCTGTGAGCACCGTGCTGACCTCCAAATACCGTTAAGCTGGAGCCTCGGTGGCCATGCTT

CTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAA

AGTCTGAGTGGGCGGCA

 

Q1:

Which BLAST program should we use in this case?

Sol:

 

 

Q2:

What are the names and accession numbers of the top ten hits from your BLAST search?

Sol:

 

Q3:

What are the percent identities for the top five hits?

Sol:

 

 

Q4:

How many identical and non identical nucleotides are there in your top hit compared to your last reported hit?

Sol:

 

 

 

Q5:

What is the “Official Symbol” and “Official Full Name” for this gene?

Sol:

 

 

Q6:

What is the “Lineage” for this gene?

Sol:

 

 

Q7:

What chromosome is this gene located on?

Sol:

 

 

Q8:

How many exons are annotated for this gene?

Sol:

 

 

Q9:

What is the function of the encoded protein?

Sol:

 

 

Q10:

Does the protein have a role in human disease(s)? If so, what diseases?

Sol:

 

 

 

LATEST TUTORIALS
New on Blog
APPROVED BY CLIENTS