Answer to Question #214511 in Molecular Biology for Moe

Molecular Biology

Question #214511

2.3) What is a polyribosome?

Expert's answer

Is an aggregation of ribosomes linked together by a molecule of messenger RNA and forming the site of protein synthesis.

Learn more about our help with Assignments: Molecular Biology

Comments

No comments. Be the first!

Leave a comment

Related Questions

1. 2.3) What are the roles of the P site, A site and E site on the large subunit of the ribosome?
2. 2.3) Discuss the functions of mRNA, rRNA and tRNA during protein synthesis.
3. 2.3) Give short explanations for the following terms: promoter; “upstream” end of a transcriptio
4. 2.3) Tabulate the similarities and differences between DNA polymerase and RNA polymerase.
5. 2.3) Tabulate four differences between DNA replication and RNA transcription.
6. 2.3) From this sense strand of DNA:5’ATGCCGGGGTGATCTACGTAGATTGCAAAAATGA3’ give the complementar
7. 2.2) Construct a diagram of the Central Dogma of gene expression for eukaryotes. Use the following t