Answer to Question #214505 in Molecular Biology for Moe

Question #214505

2.3) From this sense strand of DNA:

5’ATGCCGGGGTGATCTACGTAGATTGCAAAAATGA3’ give the complementary antisense DNA strand. Given that GAUCU and UUGCA are introns, give the modified mRNA strand to be transcribed from the sense strand and the protein sequence that will follow.


1
Expert's answer
2021-08-03T05:05:02-0400

The complementary antisense DNA strand is: we will replace the T with A and C with G. So answer is

TACGGCCCCACTAGATGCATCTAACGTT

mRNA 5'GAAAA3'


Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Comments

No comments. Be the first!

Leave a comment

Ask Your question

LATEST TUTORIALS
New on Blog
APPROVED BY CLIENTS