107 725
Assignments Done
100%
Successfully Done
In April 2024
In April 2024
Your physics assignments can be a real challenge, and the due date can be really close — feel free to use our assistance and get the desired result.
Physics
Be sure that math assignments completed by our experts will be error-free and done according to your instructions specified in the submitted order form.
Math
Our experts will gladly share their knowledge and help you with programming projects. Keep up with the world’s newest programming trends.
Programming
Answer to Question #161593 in Molecular Biology for Virat
Question #161593
The polypeptide consists of the following amino acids: valine - alanine - glycine - lysine - tryptophan - valine - serine - glutamic acid - determine the amino acid sequence using the genetic code.
Expert's answer
Assuming that the question requires us to determine the base sequence using the genetic code;
We will use the RNA genetic code
The answer will be;
AUGGUAGCAGGAAAGUGGGUAUCAGAGUAA
The first and the last codons being Start and Stop codons respectively
Learn more about our help with Assignments: Molecular Biology
Comments
Leave a comment