77 363
Assignments Done
Successfully Done
In July 2019

Answer to Question #74666 in Microbiology for Chevel Johnson

Question #74666
you sequence the DNA of the tryptophanase operon promoter and obtain the DNA sequence shown below. Underline and name the two critical regions needed for binding the sigma 70 factor -40 AGAATAGACAAAAACTCTGAGTGTAATAATGCCTCGTAGATCG +6
Expert's answer

Not answered

Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!


No comments. Be first!

Leave a comment

Ask Your question

Privacy policy Terms and Conditions