Bioinformatics Answers

The frequent words with mismatches problem

One way to solve the Frequent Words with Mismatches problem is to generate all 4^k k-mers Pattern, compute ApproximatePatternCount(Text, Pattern, d) for each k-mer Pattern, and then find k-mers with the maximum number of approximate occurrences. This is an inefficient approach in practice, since many of the 4^k k-mers should not be considered because neither they nor their mutated versions (with up to d mismatches) appear in Text.

Genome= GCAAAATGGAGCAGGATCAGCAAAATGGAAAATAAATGGAGGATCAAAATAAATGGAGGAGGAAAATGGAGGAAAATAAATGGATCAGGAAAATGCAGCAGGATCATCATCAGGAGCAGGATCAAAATTCAGGAGCAGGAGGATCAGCATCAGGAGGATCAGCAGGAAAATGCAGGAGGAGGAGGAAAATTCAAAATGGAGGAGGAGGAGCATCAGCAGCATCAGGAGGAGGATCAGCAGCAGGAGGAGGAGGAGGAAAATGGAGGAGGAGCAGGAGGAGCATCAGGAGGATCAGGAGCATCAGCAAAATTCAAAATGGAGGAAAATGCAGGAAAATGGAGCAGGAAAATAAATTCATCAAAATGCAGGAGGA

k= 6

d= 2

What connects upper limbs and vertical column

Outline the steps used to find values for a BLOSUM amino acid similarity matrix.

What are different nucleotide and protein databases? Describe the salient features of each with emphasis on pros and cons. 

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated?