107 725
Assignments Done
96.6%
Successfully Done
In April 2024
In April 2024
Your physics assignments can be a real challenge, and the due date can be really close — feel free to use our assistance and get the desired result.
Physics
Be sure that math assignments completed by our experts will be error-free and done according to your instructions specified in the submitted order form.
Math
Our experts will gladly share their knowledge and help you with programming projects. Keep up with the world’s newest programming trends.
Programming
Answer to Question #99301 in Bioinformatics for Mimo
Question #99301
AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAA
Write the nucleotide sequence for T7 promoter
Write the nucleotide sequence for T7 promoter
Expert's answer
Dear Mimo, your question requires a lot of work, which neither of our experts is ready to perform for free. We advise you to convert it to a fully qualified order and we will try to help you. Please click the link below to proceed: Submit order
Learn more about our help with Assignments: Bioinformatics
"assignmentexpert.com" is professional group of people in Math subjects! They did assignments in very high level of mathematical modelling in the best quality. Thanks a lot
#339914 on Dec 2023
#339914 on Dec 2023
Comments
Leave a comment