Answer to Question #158282 in Bioinformatics for M Umair Naseer

Question #158282

CS444: BIOINFORMATICS (Assignment 1 - Lab)

(To be made handwritten)

 

The following transcript was found to be abundant in a human patient’s blood sample.

>Example

ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCATGGTGCTGTCTCCTGCCGACAAGACCAACGTC

AAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCC

TGTCCTTCCCCACCACCAAGACCTACTTCCCGCACTTCGACCTGAGCCACGGCTCTGCCCAGGTTAAGGG

CCACGGCAAGAAGGTGGCCGACGCGCTGACCAACGCCGTGGCGCACGTGGACGACATGCCCAACGCGCTG

TCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCCGGTCAACTTCAAGCTCCTAAGCCACT

GCCTGCTGGTGACCCTGGCCGCCCACCTCCCCGCCGAGTTCACCCCTGCGGTGCACGCCTCCCTGGACAA

GTTCCTGGCTTCTGTGAGCACCGTGCTGACCTCCAAATACCGTTAAGCTGGAGCCTCGGTGGCCATGCTT

CTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAA

AGTCTGAGTGGGCGGCA

 

Q1:

Which BLAST program should we use in this case?

Sol:

 

 

Q2:

What are the names and accession numbers of the top ten hits from your BLAST search?

Sol:

 

Q3:

What are the percent identities for the top five hits?

Sol:

 

 

Q4:

How many identical and non identical nucleotides are there in your top hit compared to your last reported hit?

Sol:

 

 

 

Q5:

What is the “Official Symbol” and “Official Full Name” for this gene?

Sol:

 

 

Q6:

What is the “Lineage” for this gene?

Sol:

 

 

Q7:

What chromosome is this gene located on?

Sol:

 

 

Q8:

How many exons are annotated for this gene?

Sol:

 

 

Q9:

What is the function of the encoded protein?

Sol:

 

 

Q10:

Does the protein have a role in human disease(s)? If so, what diseases?

Sol:

 

 

 

1
Expert's answer
2021-01-28T07:20:09-0500

Q1:

Nucleotide BLAST (BLASTN)

Q2:

Homo sapiens hemoglobin subunit alpha 1 (HBA1), mRNA NM_000558.5

Homo sapiens hemoglobin, alpha 1, mRNA (cDNA clone MGC:14541 IMAGE:4047053), complete cds BC005931.1

Homo sapiens mRNA for alpha 2 globin variant, clone: FCC107C11 AK223392.1

Homo sapiens hemoglobin, alpha 1, mRNA (cDNA clone MGC:29691 IMAGE:4849981), complete cds BC032122.2

Homo sapiens hemoglobin, alpha 1, mRNA (cDNA clone MGC:60177 IMAGE:5209215), complete cds BC050661.1

Homo sapiens hemoglobin subunit alpha 2 (HBA2), mRNA NM_000517.6

Homo sapiens messenger mRNA for hemoglobin alpha chain V00493.1

Homo sapiens hemoglobin, alpha 1, mRNA (cDNA clone MGC:17020 IMAGE:4177243), complete cds BC008572.1

Homo sapiens full length insert cDNA clone YB24D09 AF147332.1

Q3:

100.00% NM_000558.5

100.00% BC005931.1

99.83% AK223392.1

100.00% BC032122.2

100.00% BC050661.1

Q4:

All are identical

Q5:

HBA1, hemoglobin subunit alpha 1()

Q6:

Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo

Q7:

Chromosome 16

Q8:

Three exons

Q9:

HBA1 encodes hemoglobin subunit alpha - a component of hemoglobin that performs the transportation of the oxygen in the blood.

Q10:

Alpha thalassemias result from deletions of each of the alpha genes as well as deletions of both HBA2 and HBA1


Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Comments

No comments. Be the first!

Leave a comment

Ask Your question

LATEST TUTORIALS
New on Blog
APPROVED BY CLIENTS