Answer to Question #154316 in Bioinformatics for Moeen

Question #154316

(b) For the given DNA coding sequence, generate an RNA sequence.


DNA Sequence: CGATGCCTCGCTAGAGGCTCGAAAGCTCTTTCGGAGATAATCG


RNA Sequence:




String Parenthesis Representation:


Arch Diagram:


1
Expert's answer
2021-01-11T07:02:27-0500

An RNA sequence only differs from a DNA sequence by a changes in T for U base. From that DNA sequence the RNA sequence will be as follow.

GCUACGGAGCGAUCUCCGAGCUUUCGAGAAAGCCUCUAUUAGC

From this DNA sequence, we have two types of palindromes: The one with inverted repeats which include 5' AGAACAnnnTGTTCT 3' and

3' TCTTGTnnnACAAGA 5'



Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Comments

No comments. Be the first!

Leave a comment

Ask Your question

LATEST TUTORIALS
New on Blog
APPROVED BY CLIENTS