77 367
Assignments Done
98,8%
Successfully Done
In July 2019

Questions: 427

Free Answers by our Experts: 353

It is very hard to master any of programming language and many students have troubles with it. That is why we have decided to render assistance for those who have difficulties with Python. Python problems are very common among students. They are tired of constant Python questions and try to find the Python answers. Ask your questions here and be sure to get the 100% truthful answers. The only thing you will have to do – is to send the request with Python questions and to have no hesitation that all your Python questions will be satisfied.

Ask Your question

Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Search & Filtering

Write a function in this file called nine_lines that uses the function three_lines (provided below) to print a total of nine lines.

Now add a function named clear_screen that uses a combination of the functions nine_lines, three_lines, and new_line (provided below) to print a total of twenty-five lines. The last line of your program should call the function clear_screen.

The function three_lines and new_line are defined below so that you can see nested function calls. Also, to make counting “blank” lines visually easier, the print command inside new_line will print a dot at the beginning of the line:

def new_line():

print('.')

def three_lines():

new_line()

new_line()

new_line()
Given a list of strings, return the count of the number of
strings where the string length is 2 or more and the first
and last chars of the string are the same.
Word1= ['aba', 'xyz', 'aa', 'x', 'bbb']
Word2 = ['', 'x', 'xy', 'xyx', 'xx']
Word3 = ['aaa', 'be', 'abc', 'hello']
1. What gets printed?
while a = 10:
print('Howdy')

2. What is printed by the python code?
Print 14/4, 14%4, 14.0/4

3. What is printed by the python code?
print '2' + '3'

4. What is printed by the Python code?
for i in range(4):
print (i)

5. Given a string s, write a short expression for a string that includes s repeated five times.
1. What will be the result of print W?
s=["apples", "bananas", "carrots]
W=[len(w) for w in s]

2. What is the output of print "hello"+1+2+3

3. What gets printed?
name = "snow storm"
name[5] = 'X'
print name
1. What is the result of the expression shown below if x = 56.236?
print("%.2f"%x)
a)56.00
b)56.24
c)56.23
d)0056.236

2. What is the output of the following?
x = ['ab', 'cd']
for i in x:
i.upper()
print (x)
a)['ab', 'cd']
b)['AB', 'CD']
c)[None, None]
d)none of the mentioned
Consider the following statements. Explain why some statements fail and correct the errors. In the case of no error give the correct answer.
a. x=1; print 'sin(%g)=%g' % (x, sin(x))
b. C=A+B; A=3; B=2; print C
c. C=21.0; F=9.*(C/5.0)+32; print F
d. t=(2, 4, 6, 'temp.pdf'); t[1]=4; print t
An example of a length 21 DNA string (whose alphabet contains the symbols 'A', 'C', 'G', and 'T') is "ATGCTTCAGAAAGGTCTTACG"...just use that in the answer)

Given: A DNA string s of length at most 1000 nt.

Write python code to return four integers (separated by spaces) counting the respective number of times that the symbols 'A', 'C', 'G', and 'T' occur in s.
For this lab you will find the area of an irregularly shaped room with the shape as shown above.

Ask the user to enter the values for sides A, B, C, D, and E and print out the total room area.

Remember the formula for finding the area of a rectangle is length * width and the area of a right triangle is 0.5 * the base * height.

Please note the final area should be in decimal format.

Sample Run

Enter side A: 11
Enter side B: 2
Enter side C: 4
Enter side D: 7
Enter side E: 1
Output

Room Area: 53.5
This is api documentation- http://api.citybik.es/v2/
i need to create programme where user will choose country by input and if there is this city -> http://api.citybik.es/v2/networks i want to create object for city and save its infoin it. like city name, longitude, latitude and companies . after that my programme should print name of companies which are in the city that she/ he have choosen
A positive integer m is a sum of squares if it can be written as k + x where k > 0, x > 0 and both k and x are perfect squares. Write a Python function sumofsquares(m) that takes an integer m returns True if m is a sum of squares and False otherwise. Here are some examples to show how your function should work.
>>> sumofsquares(41) should return True
>>> sumofsquares(30) should return False
>>> sumofsquares(17) should return True
Submit
Privacy policy Terms and Conditions