Answer to Question #158279 in Bioinformatics for M Umair Naseer

Question #158279

CS444: BIOINFORMATICS (Assignment 1)

Q1: What is the complement to the DNA sequence given below?

5’-ACCAAACAAAGTTGGGTAAGGATAGATCAATCAATGATCATATTCTAGTACACTTAGGATTCAAGATCCT

ATTATCAGGGACAAGAGCAGGATTAGGGATATCCGAGATGGCCACACTTTTGAGGAGCTTAGCATTGTTC

AAAAGAAACAAGGACAAACCACCCATTACATCAGGATCCGGTGGAGCCATCAGAGGAATCAAACACATTA

TTATAGTACCAATTCCTGGAGATTCCTCAATTACCACTCGATCCAGACTACTGGACCGGTTGGTCAGGTT

AATTGGAAACCCGGATGTGAGCGGGCCCAAACTAACAGGGGCACTAATAGGTATATTATCCTTATTTGTG

GAGTCTCCAGGTCAATTGATTCAGAGGATCACCGATGACCCTGACGTTAGCATCAGGCTGTTAGAGGTTG

TTCAGAGTGACCAGTCACAATCTGGCCTTACCTTCGCATCAAGAGGTACCAACATGGAGGATGAGGCGGA

CCAATACTTTTCACATGATGATCCAAGCAGTAGTGATCAATCCAGGTCCGGATGGTTCGAGAACAAGGAA

ATCTCAGATATTGAAGTGCAAGACCCTGAGGGATTCAACATGATTCTGGGTACCATTCTAGCCCAGATCT

GGGTCTTGCTCGCAAAGGCGGTTACGGCCCCAGACACGGCAGCTGATTCGGAGCTAAGAAGGTGGATAAA

GTACACCCAACAAAGAAGGGTAGTTGGTGAATTTAGATTGGAGAGAAAATGGTTGGATGTGGTGAGGAAC

AGGATTGCCGAGGACCTCTCTTTACGCCGATTCATGGTGGCTCTAATCCTGGATATCAAGAGGACACCCG

GGAACAAACCTAGGATTGCTGAAATGATATGTGACATTGATACATATATCGTAGAGGCAGGATTAGCCAG

TTTTATCCTGACTATTAAGTTTGGGATAGAAACTATGTATCCTGCTCTTGGACTGCATGAATTTGCTGGT

GAGTTATCCACACTTGAGTCCTTGATGAATCTTTACCAGCAAATGGGAGAAACTGCACCCTACATGGTAA-3’

Q2: What is the mRNA sequence of the given DNA sequence in Q1?

Q3: What is the protein sequence formed from the mRNA sequence of Q2?

Q4: What will be the mRNA encoded sequence if all the “AT”s are mutated into “TA”s in Q1 DNA sequence?

Q5: What will be the protein sequence of the new mRNA sequence formed after Q4?

1
Expert's answer
2021-01-29T05:49:50-0500

Q1: Complement sequence:

3'-TGGTTTGTTTCAACCCATTCCTATCTAGTTAGTTACTAGTATAAGATCATGTGAATCCTAAGTTCTAGGATAATAGTCCCTGTTCTCGTCCTAATCCCTATAGGCTCTACCGGTGTGAAAACTCCTCGAATCGTAACAAGTTTTCTTTGTTCCTGTTTGGTGGGTAATGTAGTCCTAGGCCACCTCGGTAGTCTCCTTAGTTTGTGTAATAATATCATGGTTAAGGACCTCTAAGGAGTTAATGGTGAGCTAGGTCTGATGACCTGGCCAACCAGTCCAATTAACCTTTGGGCCTACACTCGCCCGGGTTTGATTGTCCCCGTGATTATCCATATAATAGGAATAAACACCTCAGAGGTCCAGTTAACTAAGTCTCCTAGTGGCTACTGGGACTGCAATCGTAGTCCGACAATCTCCAACAAGTCTCACTGGTCAGTGTTAGACCGGAATGGAAGCGTAGTTCTCCATGGTTGTACCTCCTACTCCGCCTGGTTATGAAAAGTGTACTACTAGGTTCGTCATCACTAGTTAGGTCCAGGCCTACCAAGCTCTTGTTCCTTTAGAGTCTATAACTTCACGTTCTGGGACTCCCTAAGTTGTACTAAGACCCATGGTAAGATCGGGTCTAGACCCAGAACGAGCGTTTCCGCCAATGCCGGGGTCTGTGCCGTCGACTAAGCCTCGATTCTTCCACCTATTTCATGTGGGTTGTTTCTTCCCATCAACCACTTAAATCTAACCTCTCTTTTACCAACCTACACCACTCCTTGTCCTAACGGCTCCTGGAGAGAAATGCGGCTAAGTACCACCGAGATTAGGACCTATAGTTCTCCTGTGGGCCCTTGTTTGGATCCTAACGACTTTACTATACACTGTAACTATGTATATAGCATCTCCGTCCTAATCGGTCAAAATAGGACTGATAATTCAAACCCTATCTTTGATACATAGGACGAGAACCTGACGTACTTAAACGACCACTCAATAGGTGTGAACTCAGGAACTACTTAGAAATGGTCGTTTACCCTCTTTGACGTGGGATGTACCATT-5'

Q2: mRNA sequence:

5'-ACCAAACAAAGUUGGGUAAGGAUAGAUCAAUCAAUGAUCAUAUUCUAGUACACUUAGGAUUCAAGAUCCUAUUAUCAGGGACAAGAGCAGGAUUAGGGAUAUCCGAGAUGGCCACACUUUUGAGGAGCUUAGCAUUGUUCAAAAGAAACAAGGACAAACCACCCAUUACAUCAGGAUCCGGUGGAGCCAUCAGAGGAAUCAAACACAUUAUUAUAGUACCAAUUCCUGGAGAUUCCUCAAUUACCACUCGAUCCAGACUACUGGACCGGUUGGUCAGGUUAAUUGGAAACCCGGAUGUGAGCGGGCCCAAACUAACAGGGGCACUAAUAGGUAUAUUAUCCUUAUUUGUGGAGUCUCCAGGUCAAUUGAUUCAGAGGAUCACCGAUGACCCUGACGUUAGCAUCAGGCUGUUAGAGGUUGUUCAGAGUGACCAGUCACAAUCUGGCCUUACCUUCGCAUCAAGAGGUACCAACAUGGAGGAUGAGGCGGACCAAUACUUUUCACAUGAUGAUCCAAGCAGUAGUGAUCAAUCCAGGUCCGGAUGGUUCGAGAACAAGGAAAUCUCAGAUAUUGAAGUGCAAGACCCUGAGGGAUUCAACAUGAUUCUGGGUACCAUUCUAGCCCAGAUCUGGGUCUUGCUCGCAAAGGCGGUUACGGCCCCAGACACGGCAGCUGAUUCGGAGCUAAGAAGGUGGAUAAAGUACACCCAACAAAGAAGGGUAGUUGGUGAAUUUAGAUUGGAGAGAAAAUGGUUGGAUGUGGUGAGGAACAGGAUUGCCGAGGACCUCUCUUUACGCCGAUUCAUGGUGGCUCUAAUCCUGGAUAUCAAGAGGACACCCGGGAACAAACCUAGGAUUGCUGAAAUGAUAUGUGACAUUGAUACAUAUAUCGUAGAGGCAGGAUUAGCCAGUUUUAUCCUGACUAUUAAGUUUGGGAUAGAAACUAUGUAUCCUGCUCUUGGACUGCAUGAAUUUGCUGGUGAGUUAUCCACACUUGAGUCCUUGAUGAAUCUUUACCAGCAAAUGGGAGAAACUGCACCCUACAUGGUAA-3'

Q3: Protein sequence:

MATLLRSLALFKRNKDKPPITSGSGGAIRGIKHIIIVPIPGDSSITTRSRLLDRLVRLIGNPDVSGPKLTGALIGILSLFVESPGQLIQRITDDPDVSIRLLEVVQSDQSQSGLTFASRGTNMEDEADQYFSHDDPSSSDQSRSGWFENKEISDIEVQDPEGFNMILGTILAQIWVLLAKAVTAPDTAADSELRRWIKYTQQRRVVGEFRLERKWLDVVRNRIAEDLSLRRFMVALILDIKRTPGNKPRIAEMICDIDTYIVEAGLASFILTIKFGIETMYPALGLHEFAGELSTLESLMNLYQQMGETAPYMV

Q4: Mutated mRNA:

5'-UGGUUUGUUUCAACCCUAUCCUUACUAGUUAGUUACUAGUUAAAGUACUAGUGAUACCUAAGUUCUAGGUAAUAAGUCCCUGUUCUCGUCCUAUACCCUUAAGGCUCUACCGGUGUGAAAACUCCUCGAUACGUAACAAGUUUUCUUUGUUCCUGUUUGGUGGGUAUAGUAGUCCUAGGCCACCUCGGUAGUCUCCUUAGUUUGUGUAUAAUAUACUAGGUUAAGGACCUCUAAGGAGUUAUAGGUGAGCUAGGUCUGUAGACCUGGCCAACCAGUCCAUAUAACCUUUGGGCCUACACUCGCCCGGGUUUGUAUGUCCCCGUGUAUUACCUAUAAUAAGGAUAAAACACCUCAGAGGUCCAGUUAACUAAGUCUCCUAGUGGCUACUGGGACUGCAUACGUAGUCCGACAUACUCCAACAAGUCUCACUGGUCAGUGUUAGACCGGAUAGGAAGCGUAGUUCUCCUAGGUUGUACCUCCUACUCCGCCUGGUUUAGAAAAGUGUACUACUAGGUUCGUCUACACUAGUUAGGUCCAGGCCUACCAAGCUCUUGUUCCUUUAGAGUCUUAAACUUCACGUUCUGGGACUCCCUAAGUUGUACUAAGACCCUAGGUAAGUACGGGUCUAGACCCAGAACGAGCGUUUCCGCCAUAGCCGGGGUCUGUGCCGUCGACUAAGCCUCGUAUCUUCCACCUUAUUCUAGUGGGUUGUUUCUUCCCUACAACCACUUAAUACUAACCUCUCUUUUACCAACCUACACCACUCCUUGUCCUAACGGCUCCUGGAGAGAAUAGCGGCUAAGUACCACCGAGUAUAGGACCUUAAGUUCUCCUGUGGGCCCUUGUUUGGUACCUAACGACUUUACUUAACACUGUAACUUAGUUAUAAGCUACUCCGUCCUAUACGGUCAAAUAAGGACUGUAAUAUCAAACCCUUACUUUGUAACUAAGGACGAGAACCUGACGUACUUAAACGACCACUCAUAAGGUGUGAACUCAGGAACUACUUAGAAUAGGUCGUUUACCCUCUUUGACGUGGGUAGUACCUAU-3'

Q5: Mutated protein sequence:

MSPCITYNKDKTPQRSS


Need a fast expert's response?

Submit order

and get a quick answer at the best price

for any assignment or question with DETAILED EXPLANATIONS!

Comments

No comments. Be the first!

Leave a comment

Ask Your question

LATEST TUTORIALS
New on Blog
APPROVED BY CLIENTS